View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0231-INSERTION-5 (Length: 287)
Name: NF0231-INSERTION-5
Description: NF0231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0231-INSERTION-5 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 7 - 287
Target Start/End: Original strand, 10750280 - 10750563
Alignment:
Q |
7 |
agttaacaacattgaatgtatcgctgtaaatttgaataaaaattcaatcattttcacattacaagtccctatactattctgggtcaagctgattctgnnn |
106 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10750280 |
agttaacaacattgaatgtatcgctacaaatttgaataaaaatccaatctttttcacattacaagtccctatactattctgggtcaagctgattctgttt |
10750379 |
T |
 |
Q |
107 |
nnnnnnnnnnnnnnnn---gtgttgctgattagtacttttggattactctttcagattgtgaaaagggcttcaaaatttgattttgatgttgttgatatt |
203 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
10750380 |
tttttttttttttttttttgtgttgctgattagtacttttggattactctttcagattgtgaaaagggcttcaaaatttgattttgatgttgttgatttt |
10750479 |
T |
 |
Q |
204 |
tgtaagtgatttatgctattgtttgagttcttaaattaaaacaaacttgaagcttttgcatggagtgatggaggtgttgttgaa |
287 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10750480 |
tgtaagtgatttatgctattgtgtgagttcttaaattaaaacaaacttgaagcttttgcatggagtgatggaggtgttgttgaa |
10750563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University