View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0231_high_2 (Length: 249)
Name: NF0231_high_2
Description: NF0231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0231_high_2 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 20 - 249
Target Start/End: Original strand, 8797357 - 8797590
Alignment:
| Q |
20 |
catcatcatcattggaggacatagcccaccactgttttctccaaaagcacccatcacataagaacaacttccattagaactaccctccattgaattaata |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8797357 |
catcatcatcattggaggacatagcccaccactgttttctccaaaagcacccatcacataagaacaacttccattagaactaccctccattgaattaata |
8797456 |
T |
|
| Q |
120 |
ctc--------actcacttagccacaataacacttcctttttattaccctttttgccttctaggtcagatttttctttctctcacttgaatgaatgatat |
211 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8797457 |
ctcactcactcactcacttagccacaataacacttcctttttattaccctttttgccttctaggtcagatttttctttctctcact----tgaatgatat |
8797552 |
T |
|
| Q |
212 |
taatattgaagatgtttttgtttcacacaagggtcacc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8797553 |
taatattgaagatgtttttgtttcacacaagggtcacc |
8797590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1861 times since January 2019
Visitors: 2394