View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0231_low_2 (Length: 297)

Name: NF0231_low_2
Description: NF0231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0231_low_2
NF0231_low_2
[»] scaffold0171 (1 HSPs)
scaffold0171 (124-222)||(11062-11160)


Alignment Details
Target: scaffold0171 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: scaffold0171
Description:

Target: scaffold0171; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 124 - 222
Target Start/End: Complemental strand, 11160 - 11062
Alignment:
124 atatggaagttaggaaaattgcttacaacgatgaaactcgtgacattctccttgtttaacttgatcccaatctcagtgttattgttctcatgaatttcc 222  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11160 atatggaagttaggagaattgcttacaacgatgaaactcgtgacattctccttgtttaacttgatcccaatctcagtgttattgttctcatgaatttcc 11062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University