View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235-INSERTION-10 (Length: 154)
Name: NF0235-INSERTION-10
Description: NF0235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0235-INSERTION-10 |
 |  |
|
[»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 132; Significance: 7e-69; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 132; E-Value: 7e-69
Query Start/End: Original strand, 7 - 154
Target Start/End: Original strand, 4932208 - 4932355
Alignment:
Q |
7 |
atctggatcgttcgatcttgatggaacaaccaccaacatttcaatcgcgtgaatgctaagaatccatggctgtcggggtgccgaatccaaatatttgatt |
106 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
4932208 |
atctggatcgtttgatcttgatggaacaaccaccaacatttcaatcgcgtgaatgctaagaatccctggctgtcggggtgccgaatccaaatatttgatt |
4932307 |
T |
 |
Q |
107 |
aggcaaacattataattgagaggcattgtcacttgataatttcttttt |
154 |
Q |
|
|
||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
4932308 |
aggcagacattataattgagacgcattgtcacttgataatttcttttt |
4932355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University