View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235-INSERTION-14 (Length: 440)
Name: NF0235-INSERTION-14
Description: NF0235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235-INSERTION-14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 8 - 354
Target Start/End: Original strand, 27448688 - 27449034
Alignment:
| Q |
8 |
tcaacatgcttcaaagctgcaagaatctctacagtaatcttcgatgatgggatgcatttggacaaaatacttgatactgaatggcacaggagttttactc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27448688 |
tcaacatgcttcaaagctgcaagaatctctacagtgatcttcgatgatgggatacatttggacaaaatacttgatactgaatggcacaggagttttactc |
27448787 |
T |
|
| Q |
108 |
ctcaggttgctagactcgtgagagttgaacgccttgctgagaatatactaaatgaagtgagattcttattcacattcacttttaattcatgcatttgtat |
207 |
Q |
| |
|
|||| || |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27448788 |
ctcatgtcgctagactcgtgagagttgaacgccttgctgaaaatatcctaaatgaagtgagattcttattcacattcacttttaattcatgcatttgtat |
27448887 |
T |
|
| Q |
208 |
ctatgaaacgctgacacagataccaaacatgatactcatagttaaacaagtagcattgatgcttaacgggatttgcagttggtatatcagtcaacaactt |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| ||||| |||| |
|
|
| T |
27448888 |
ctatgaaacgctgacacagataccaaacatgatactcatagttaaacaagtagcattgatgcttaatgtgatttgcagttggtatatccatcaaccactt |
27448987 |
T |
|
| Q |
308 |
agatttgttgtcgaaaaagttattgttcaaattacacaattgttcta |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27448988 |
agatttgttgtcgaaaaagttattgttcaaattacacaattgttcta |
27449034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1097 times since January 2019
Visitors: 2389