View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235-INSERTION-6 (Length: 301)
Name: NF0235-INSERTION-6
Description: NF0235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235-INSERTION-6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 7e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 145 - 297
Target Start/End: Original strand, 17915129 - 17915281
Alignment:
| Q |
145 |
ttaggactgctaaagattctgccttacacagtgatatagaaggagactcctccattccaaagatagagcttcattctacaacgacgagttccttcaatga |
244 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||| ||||||||||||||||||||||| || |||||||| |||||||||| ||||||||||| |
|
|
| T |
17915129 |
ttaggactgctaaagattctgccttacataatgatatagagagagactcctccattccaaagataaagtttcattcttcaacgacgagatccttcaatga |
17915228 |
T |
 |
| Q |
245 |
aacatcgttgaatagcaatgttttgctcgatgacaccgcatcaacttcttcca |
297 |
Q |
| |
|
| |||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
17915229 |
agcatcgttgaatagcaatgctttgctccatgacaccgcatcaacttcttcca |
17915281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 26 - 147
Target Start/End: Complemental strand, 17975641 - 17975520
Alignment:
| Q |
26 |
ataggttaattgggatgaacataaagccttgcaggttctagagcgagtcagtccgtgggaggttgagattatttccaacatacatccactgcatcgacag |
125 |
Q |
| |
|
||||||||| |||||||||| ||||| || |||||||| ||||||||||||||| ||||||||||| | ||||||| ||||| | ||||||||| ||| |
|
|
| T |
17975641 |
ataggttaaatgggatgaacctaaagtctcgcaggttccagagcgagtcagtccttgggaggttgaaactatttccgacatatttgcactgcatccacaa |
17975542 |
T |
 |
| Q |
126 |
ttccctcgaacaaaaaagctta |
147 |
Q |
| |
|
|||| | ||||||||||||| |
|
|
| T |
17975541 |
ttccacccgacaaaaaagctta |
17975520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University