View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235-Insertion-20 (Length: 157)
Name: NF0235-Insertion-20
Description: NF0235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235-Insertion-20 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 1e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 1e-79
Query Start/End: Original strand, 8 - 157
Target Start/End: Original strand, 37842694 - 37842843
Alignment:
| Q |
8 |
atttttagtatgtttagaaagaaaatgttaggcttgaaatgatgatcttgtttcaacaaaaagaaatatttaaatgatcaagtaacggtgcgtgtttctt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37842694 |
atttttagtatgtttagaaagaaaatgttaggcttgaaatgatgatcttgtttcaacaaaaagaaatatttaaatgatcaagtaacggtgcgtgtttctt |
37842793 |
T |
|
| Q |
108 |
ttttctcaagaatggataaatctaaagcaaaattataagatgtgttctcc |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37842794 |
ttttctcaagaatggataaatctaaagcaaaattataagatgtgttctcc |
37842843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1464 times since January 2019
Visitors: 2391