View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235-Insertion-21 (Length: 69)
Name: NF0235-Insertion-21
Description: NF0235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235-Insertion-21 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 51; Significance: 6e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 8 - 69
Target Start/End: Complemental strand, 3331556 - 3331492
Alignment:
| Q |
8 |
taattaaattgatgtatccttattattat---ctatcctcggtgagtttgtttaattttattcta |
69 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3331556 |
taattaaattgatgtatccttattattattatctatcctcggtgagtttgtttaattttattcta |
3331492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University