View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235-Insertion-23 (Length: 81)
Name: NF0235-Insertion-23
Description: NF0235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235-Insertion-23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 5e-34; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 5e-34
Query Start/End: Original strand, 8 - 80
Target Start/End: Complemental strand, 374626 - 374554
Alignment:
| Q |
8 |
ctgggtttgaaattttttgagggggtaatgttattcattctattgggttttaatttttcatataaaaatttat |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
374626 |
ctgggtttgaaattttttgagggggtaatgttattcattctattgggttttaatttttcatataaaaatttat |
374554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 75
Target Start/End: Complemental strand, 374879 - 374832
Alignment:
| Q |
28 |
gggggtaatgttattcattctattgggttttaatttttcatataaaaa |
75 |
Q |
| |
|
||||||||||||| |||||||||| |||| || ||||||||| ||||| |
|
|
| T |
374879 |
gggggtaatgttactcattctatttggttctagtttttcataaaaaaa |
374832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 35 - 70
Target Start/End: Complemental strand, 374998 - 374963
Alignment:
| Q |
35 |
atgttattcattctattgggttttaatttttcatat |
70 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||| |
|
|
| T |
374998 |
atgttgtttattctattgggttttaatttttcatat |
374963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 11 - 70
Target Start/End: Complemental strand, 385249 - 385191
Alignment:
| Q |
11 |
ggtttgaaattttttgagggggtaatgttattcattctattgggttttaatttttcatat |
70 |
Q |
| |
|
||||||| ||||||||||||| || |||||||||||| || | |||||||||||||||| |
|
|
| T |
385249 |
ggtttgagattttttgaggggc-aacgttattcattctgttagtttttaatttttcatat |
385191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University