View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235-Insertion-28 (Length: 293)
Name: NF0235-Insertion-28
Description: NF0235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235-Insertion-28 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 41 - 288
Target Start/End: Complemental strand, 55269018 - 55268771
Alignment:
| Q |
41 |
tacatactataaatcattcatttaatccatttataattgaagttgaactaataactcccacttattttagttcaagtgtgagtgagtaattaaacggatt |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55269018 |
tacatactataaatcattcatttaatccatttataattgaagttgaactaataactcccacttattttagttcaagtgtgagtgagtaattaaacggatt |
55268919 |
T |
 |
| Q |
141 |
aaaaacaacattggaggtactatgcaaattccaaacaacacctaaggatgtcaacggggtcgatgggggtactcctctgctccgtagatggggttgcata |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
55268918 |
aaaaacaacattggaggtactatgcaaattccaaacaacacctaaggatgtcaacggggtcgatgggggtactcctctgcttcttagatggggttgcata |
55268819 |
T |
 |
| Q |
241 |
ctctctaggagtgcgttcctcaaccatatcgtttttgtttttgtgtgt |
288 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
55268818 |
ctctctaggagtgcgttcctcagccatatcgtttttgtttttgtgtgt |
55268771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 8 - 41
Target Start/End: Complemental strand, 55269087 - 55269054
Alignment:
| Q |
8 |
aaagcaaccataatccattacttctattttatat |
41 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
55269087 |
aaagcaaccataatccattacttctattttatat |
55269054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 225 - 293
Target Start/End: Complemental strand, 29952612 - 29952544
Alignment:
| Q |
225 |
tagatggggttgcatactctctaggagtgcgttcctcaaccatatcgtttttgtttttgtgtgtgtttc |
293 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||| | ||||||||| |||||||||||||||||| |
|
|
| T |
29952612 |
tagatggggttgcatactctctaagagtgtgttcctcagctatatcgtttctgtttttgtgtgtgtttc |
29952544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 273
Target Start/End: Complemental strand, 25950348 - 25950296
Alignment:
| Q |
221 |
tccgtagatggggttgcatactctctaggagtgcgttcctcaaccatatcgtt |
273 |
Q |
| |
|
|||||||| ||||||||||||||| || |||||||||||||| ||||||||| |
|
|
| T |
25950348 |
tccgtagaaggggttgcatactctttaagagtgcgttcctcagtcatatcgtt |
25950296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 221 - 261
Target Start/End: Original strand, 25785490 - 25785530
Alignment:
| Q |
221 |
tccgtagatggggttgcatactctctaggagtgcgttcctc |
261 |
Q |
| |
|
|||||||||||| ||||||||||| || ||||||||||||| |
|
|
| T |
25785490 |
tccgtagatgggattgcatactctttaagagtgcgttcctc |
25785530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University