View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235-Insertion-29 (Length: 139)
Name: NF0235-Insertion-29
Description: NF0235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0235-Insertion-29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 1e-63; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 1e-63
Query Start/End: Original strand, 8 - 130
Target Start/End: Complemental strand, 37714967 - 37714845
Alignment:
Q |
8 |
gtttgcttatatacggagaaagaaaattggccacaagcttggtaataatttatggtttgacattttaaatttaaagtgtttcattgcatcaaaatacatt |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37714967 |
gtttgcttatatacggagaaagaaaattggccacaagcttggtaataatttatggtttgacattttaaatttaaagtgtttcattgcatcaaaatacatt |
37714868 |
T |
 |
Q |
108 |
taatgtaagcaaagttattataa |
130 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
37714867 |
taatgtaagcaaagttattataa |
37714845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University