View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235-Insertion-37 (Length: 77)
Name: NF0235-Insertion-37
Description: NF0235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235-Insertion-37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 53; Significance: 4e-22; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 4e-22
Query Start/End: Original strand, 7 - 63
Target Start/End: Complemental strand, 4795408 - 4795352
Alignment:
| Q |
7 |
atttaatgatttgaatattcttattttgtactctatgaattaaattagtgtgtatta |
63 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4795408 |
atttaatgatttgaatgttcttattttgtactctatgaattaaattagtgtgtatta |
4795352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1806 times since January 2019
Visitors: 2393