View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235-Insertion-46 (Length: 262)
Name: NF0235-Insertion-46
Description: NF0235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235-Insertion-46 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 8 - 262
Target Start/End: Complemental strand, 43429028 - 43428774
Alignment:
| Q |
8 |
gtacaaggttacgaaataaaatgaatagctcatacatacatgcatacatacacaaacacacggtaactgtgaatagnnnnnnn-tcaatgcatggaagaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||||||| |
|
|
| T |
43429028 |
gtacaaggttacgaaataaaatgaatagctcatacatacatgcatacatacacaaacacacgttaactatgaatagaaaaaaaatcaatgcatggaagaa |
43428929 |
T |
|
| Q |
107 |
gaaggaaccaactcactcgatatcagaatttggagataagcggnnnnnnnnn--ttactcttgttgtttctctagtcaccagaatccaaactggtcgtgg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
43428928 |
gaaggaaccaactcactcgatatcagaatttggagataagcggaaaaaaaaaaattactcttgttgtttcg--agtcacc-gaatccaaactggtcgtgg |
43428832 |
T |
|
| Q |
205 |
gggatttggattctctctttctactcattctatcttttcccccatccaccaagttgta |
262 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43428831 |
gagatttggattctctctttctactcattctatcttttcccccattcaccaagttgta |
43428774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1547 times since January 2019
Visitors: 2392