View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235Ase16 (Length: 140)
Name: NF0235Ase16
Description: NF0235-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235Ase16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 76; Significance: 2e-35; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 7 - 132
Target Start/End: Original strand, 43032307 - 43032440
Alignment:
| Q |
7 |
taatcccacaatgacatttgatacataaaagagacgacacataatgtttt--------gagtagagatgtgacgtctcannnnnnngtggtcgagctttg |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43032307 |
taatcccacaatgacatttgatacataaaagagatgacacataatgttttaaggttttgagtagagatgtgacgtctcatttttttgtggtcgagctttg |
43032406 |
T |
|
| Q |
99 |
gctagttgttgctctcgacgctctctatgtcttc |
132 |
Q |
| |
|
| |||||||||||||||||||||||||||||||| |
|
|
| T |
43032407 |
gttagttgttgctctcgacgctctctatgtcttc |
43032440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University