View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235Ase21 (Length: 248)
Name: NF0235Ase21
Description: NF0235-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0235Ase21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 7 - 242
Target Start/End: Original strand, 29421923 - 29422158
Alignment:
Q |
7 |
actagtcacctacaactgatgattcccaagaaagcatgtggtggcgcagtggtagaaaatttaccaaatatatttcagaaatcagaatgcaacttcgcca |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29421923 |
actagtcacctacaactgatgattcccaagaaagcatgtggtggcgcagtggtagaaaatttaccaaatatatttcagaaatcagaatgcaacttcgcca |
29422022 |
T |
 |
Q |
107 |
aaatctatggtcagaaaaccagctcaccaagtattttattttcaattacataatgtatcagaaggtgtgcaattaagctttactgaaaataacattttga |
206 |
Q |
|
|
|||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29422023 |
aaatctatggtcagaaaagcagctcactaagtattttattttcaattacataatgtatcagaaggtgtgcaattaagctttactgaaaataacattttga |
29422122 |
T |
 |
Q |
207 |
ggttaatttcagattatagattgagtatctgtatta |
242 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
29422123 |
ggttaatttcagattatagattgagtatctgtatta |
29422158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 137 - 242
Target Start/End: Original strand, 29457944 - 29458044
Alignment:
Q |
137 |
gtattttattttcaattacataatgtatcagaaggtgtgcaattaagctttactgaaaataacattttgaggttaatttcagattatagattgagtatct |
236 |
Q |
|
|
|||||||||||||||||||| |||||| |||||||||| |||| | |||||| ||||||||||||||||||||||||| || |||||||||||| | |
|
|
T |
29457944 |
gtattttattttcaattacagaatgtacgagaaggtgtgtaattgaactttac---aaataacattttgaggttaatttcatat--tagattgagtattt |
29458038 |
T |
 |
Q |
237 |
gtatta |
242 |
Q |
|
|
|||||| |
|
|
T |
29458039 |
gtatta |
29458044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University