View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235Ase23 (Length: 563)
Name: NF0235Ase23
Description: NF0235-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0235Ase23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 440; Significance: 0; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 440; E-Value: 0
Query Start/End: Original strand, 98 - 553
Target Start/End: Complemental strand, 7309565 - 7309110
Alignment:
Q |
98 |
cttggaagaatgagatatggaagaatgggcactggagcttcctctaattatgattccgagaactacatcaaaaaagtagaggaaccggatgttttaagga |
197 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7309565 |
cttggaagaatgagatatggaagaatgggcactggagcttcctctaattatgattccgagaactacatcaaaaaagtagaggaaccggatgttttaagga |
7309466 |
T |
 |
Q |
198 |
aaagttcgatccctaatgcagcctccggtgttggccgcagtggtgatgttaagaaagggccgatgtttaaggatttagcagggaataggatggagaagat |
297 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7309465 |
aaagttcgatccctaatgcagcctccggtgttggcagcagtggtgatgttaagaaagggccgatgtttaaggatttagcagggaataggatggagaagat |
7309366 |
T |
 |
Q |
298 |
aaagaaggaattggaagtgcctcttaatttactgtgttaccctgagttgggtaaaaagttaggtttggaaccattgacgggaattttgctgcacggacca |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7309365 |
aaagaaggaattggaagtgcctcttaatttactgtgttaccctgagttgggtaaaaagttaggtttggaaccattgacgggaattttgctgcacggacca |
7309266 |
T |
 |
Q |
398 |
cctggttgtgggaaaactagacttgctcatgctattgctaatgaaactgaacttcctttttatcctatttctgctgctgatgttgtttctggtgtcactg |
497 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
7309265 |
cctggttgtgggaaaactagacttgctcatgctattgctaatgaaactgaacttcctttttatcctatttctgctactgatgttgtttctggtgtcactg |
7309166 |
T |
 |
Q |
498 |
gtgagtatatgttattttgcttcaactttaattccattatttttgtgttaaatttt |
553 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
T |
7309165 |
gtgagtatatgttattttgcttcaactttaattccattatctgtgtgttaaatttt |
7309110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 377 - 486
Target Start/End: Complemental strand, 7299524 - 7299415
Alignment:
Q |
377 |
ggaattttgctgcacggaccacctggttgtgggaaaactagacttgctcatgctattgctaatgaaactgaacttcctttttatcctatttctgctgctg |
476 |
Q |
|
|
||||||||| | || || ||| |||||||||| ||||||| |||||| ||||||||||||||||| ||||| |||| ||||||||| | |||||| ||| |
|
|
T |
7299524 |
ggaattttgttacatgggccatctggttgtggaaaaactatgcttgcttatgctattgctaatgaagctgaagttcccttttatcctgtctctgctactg |
7299425 |
T |
 |
Q |
477 |
atgttgtttc |
486 |
Q |
|
|
|||||||||| |
|
|
T |
7299424 |
atgttgtttc |
7299415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 9e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 380 - 493
Target Start/End: Original strand, 786541 - 786654
Alignment:
Q |
380 |
attttgctgcacggaccacctggttgtgggaaaactagacttgctcatgctattgctaatgaaactgaacttcctttttatcctatttctgctgctgatg |
479 |
Q |
|
|
||||||||||| ||||||||||||||||| || |||||||||||||||||||||||||| || || | ||||||||| ||| |||||| ||| | || | |
|
|
T |
786541 |
attttgctgcatggaccacctggttgtggaaagactagacttgctcatgctattgctaacgagaccggtcttccttttcatcgtatttcggctaccgagg |
786640 |
T |
 |
Q |
480 |
ttgtttctggtgtc |
493 |
Q |
|
|
| |||||||||||| |
|
|
T |
786641 |
tggtttctggtgtc |
786654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1295 times since January 2019
Visitors: 2391