View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235Ase7 (Length: 218)
Name: NF0235Ase7
Description: NF0235-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235Ase7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 10 - 201
Target Start/End: Complemental strand, 26614656 - 26614465
Alignment:
| Q |
10 |
tacgacaacaacttatttaatactcccctgtataaaatatacgcnnnnnnngtacatgtatctgatcaaaattttagaccagatacacgtagtttcattt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26614656 |
tacgacaacaacttatttaatactcccccgtataaaatatacgcaaaaaaagtacatgtatctgatcaaaagtttagaccagatacacgtagtttcattt |
26614557 |
T |
|
| Q |
110 |
ttgcttatattttgttactttgtttatatgctcgaatgaaactcgcaatttaattttgatacacacatataanttaaatcaaagataagaag |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26614556 |
ttgcttatattttgttactttgtttatatgctcgaatgaaactcgcaatttaattttgatacacacatataaattaaatcaaagataagaag |
26614465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 64 - 96
Target Start/End: Complemental strand, 39897196 - 39897164
Alignment:
| Q |
64 |
catgtatctgatcaaaattttagaccagataca |
96 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
39897196 |
catgtatctgatcaatattttagaccagataca |
39897164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1060 times since January 2019
Visitors: 2388