View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235Ase9 (Length: 254)
Name: NF0235Ase9
Description: NF0235-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235Ase9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 7 - 246
Target Start/End: Complemental strand, 36955171 - 36954932
Alignment:
| Q |
7 |
taattttgggttttgaaaattactagatgttggatctatcgctatataattatatttgcctttctcaaaactatgtctagctgtcttgtaatgtgagagt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36955171 |
taattttgggttttgaaaattactagatgttggatctatcgctatataattatctttgcctttctcaaaactatgtctagctgtcttgtaatgtgagagt |
36955072 |
T |
|
| Q |
107 |
ccgtgcatcttgatccatgtactatacctacctaatggggaccatcattgtttctgatattattattgcaatatggatatttgagagttgaggttaggat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
36955071 |
ccgtgcatcttgatccatgtactatacctacctaatggggaccatcattgtttttgatattattattgcaatatggatatttgagagttgaggttaagat |
36954972 |
T |
|
| Q |
207 |
tcttaatttttaatgtacgttccaactactatggtagcat |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36954971 |
tcttaatttttaatgtacgttccaactactatggtagcat |
36954932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1258 times since January 2019
Visitors: 2391