View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0235Eco14 (Length: 133)

Name: NF0235Eco14
Description: NF0235-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0235Eco14
NF0235Eco14
[»] chr7 (1 HSPs)
chr7 (9-130)||(43715694-43715815)
[»] chr1 (1 HSPs)
chr1 (9-130)||(52891797-52891919)


Alignment Details
Target: chr7 (Bit Score: 114; Significance: 3e-58; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 114; E-Value: 3e-58
Query Start/End: Original strand, 9 - 130
Target Start/End: Complemental strand, 43715815 - 43715694
Alignment:
9 taccatgttttcctttcaatccatgtttctattttgaacattggcttacgagctacaacaagtgtgtgggtttcaaaaaattggatgcatctaattttgt 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
43715815 taccatgttttcctttcaatccatgtttctattttgaacattggcttacgagctacaacaagtgtgtgggttttaaaaaattggatgcatctaattttgt 43715716  T
109 atgacagatttttatgtaattg 130  Q
    |||||||||||||||| |||||    
43715715 atgacagatttttatgcaattg 43715694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 79; Significance: 2e-37; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 79; E-Value: 2e-37
Query Start/End: Original strand, 9 - 130
Target Start/End: Original strand, 52891797 - 52891919
Alignment:
9 taccatgttttcctttcaatccat-gtttctattttgaacattggcttacgagctacaacaagtgtgtgggtttcaaaaaattggatgcatctaattttg 107  Q
    |||||||||||| |||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||  || || |||||||||||||||||||    
52891797 taccatgttttcttttcaacccattgtttctattttgaacattggcttacgagctacaacaagtgtgtgggttataagaagttggatgcatctaattttg 52891896  T
108 tatgacagatttttatgtaattg 130  Q
    |||| ||| |||||||| |||||    
52891897 tatggcagttttttatgcaattg 52891919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University