View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235Eco14 (Length: 133)
Name: NF0235Eco14
Description: NF0235-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235Eco14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 3e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 3e-58
Query Start/End: Original strand, 9 - 130
Target Start/End: Complemental strand, 43715815 - 43715694
Alignment:
| Q |
9 |
taccatgttttcctttcaatccatgtttctattttgaacattggcttacgagctacaacaagtgtgtgggtttcaaaaaattggatgcatctaattttgt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43715815 |
taccatgttttcctttcaatccatgtttctattttgaacattggcttacgagctacaacaagtgtgtgggttttaaaaaattggatgcatctaattttgt |
43715716 |
T |
|
| Q |
109 |
atgacagatttttatgtaattg |
130 |
Q |
| |
|
|||||||||||||||| ||||| |
|
|
| T |
43715715 |
atgacagatttttatgcaattg |
43715694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 79; Significance: 2e-37; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 79; E-Value: 2e-37
Query Start/End: Original strand, 9 - 130
Target Start/End: Original strand, 52891797 - 52891919
Alignment:
| Q |
9 |
taccatgttttcctttcaatccat-gtttctattttgaacattggcttacgagctacaacaagtgtgtgggtttcaaaaaattggatgcatctaattttg |
107 |
Q |
| |
|
|||||||||||| |||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| || || ||||||||||||||||||| |
|
|
| T |
52891797 |
taccatgttttcttttcaacccattgtttctattttgaacattggcttacgagctacaacaagtgtgtgggttataagaagttggatgcatctaattttg |
52891896 |
T |
|
| Q |
108 |
tatgacagatttttatgtaattg |
130 |
Q |
| |
|
|||| ||| |||||||| ||||| |
|
|
| T |
52891897 |
tatggcagttttttatgcaattg |
52891919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1742 times since January 2019
Visitors: 2393