View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235Eco17 (Length: 167)
Name: NF0235Eco17
Description: NF0235-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235Eco17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 11 - 160
Target Start/End: Complemental strand, 4684053 - 4683904
Alignment:
| Q |
11 |
cataccgacggaagttgggtgttggcaggagtgaaaccaaagatacgcttagtgtttgtttgaaaaatgaaaatttcatggtgtatcatgacattttcat |
110 |
Q |
| |
|
||||| ||| |||||||| |||||||||||||||||||||| ||||| ||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4684053 |
catactgacagaagttggatgttggcaggagtgaaaccaaacatacgtttagtgtgtgtttgaaaaatggaaatttcatggtgtatcatgacattttcat |
4683954 |
T |
|
| Q |
111 |
tttccgaacacaattccaaaacatactatttaaatctacatactagagcg |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4683953 |
tttccgaacacaattccaaaacatactatttaaatctacatacttgagcg |
4683904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1915 times since January 2019
Visitors: 2394