View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0235Eco18 (Length: 196)

Name: NF0235Eco18
Description: NF0235-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0235Eco18
NF0235Eco18
[»] chr1 (4 HSPs)
chr1 (9-194)||(50407788-50407973)
chr1 (32-122)||(50385782-50385872)
chr1 (32-122)||(50394201-50394291)
chr1 (31-122)||(50390926-50391017)


Alignment Details
Target: chr1 (Bit Score: 182; Significance: 1e-98; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 9 - 194
Target Start/End: Original strand, 50407788 - 50407973
Alignment:
9 tttatcctgtgtcggtcacttattgatagcctttgatgtgcaaaatggcctctattttgcttcagtaatcattggattttgttttggtgcacaatggcca 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
50407788 tttatcctgtgtcggtcacttattgatagcctttgatgtgcaaaatggcatctattttgcttcagtaatcattggattttgttttggtgcacaatggcca 50407887  T
109 ttggtttttgccataatttcggagttgtttgggttgaaatattattcaactttgatgaactttggtggggtagctagtccaattgg 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50407888 ttggtttttgccataatttcggagttgtttgggttgaaatattattcaactttgatgaactttggtggggtagctagtccaattgg 50407973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 32 - 122
Target Start/End: Original strand, 50385782 - 50385872
Alignment:
32 tgatagcctttgatgtgcaaaatggcctctattttgcttcagtaatcattggattttgttttggtgcacaatggccattggtttttgccat 122  Q
    ||||||| |||||||||| | | || |||||  | |||||||| || |||||||||||||||||||| |||||||||||  ||||||||||    
50385782 tgatagcatttgatgtgccagagggtctctacgtagcttcagtgattattggattttgttttggtgctcaatggccattactttttgccat 50385872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 32 - 122
Target Start/End: Original strand, 50394201 - 50394291
Alignment:
32 tgatagcctttgatgtgcaaaatggcctctattttgcttcagtaatcattggattttgttttggtgcacaatggccattggtttttgccat 122  Q
    ||||||| |||||||||| | | || |||||  | |||||||| || |||||||||||||||||||| |||||||||||  ||||||||||    
50394201 tgatagcatttgatgtgccagagggtctctacgtagcttcagtgattattggattttgttttggtgctcaatggccattactttttgccat 50394291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 31 - 122
Target Start/End: Original strand, 50390926 - 50391017
Alignment:
31 ttgatagcctttgatgtgcaaaatggcctctattttgcttcagtaatcattggattttgttttggtgcacaatggccattggtttttgccat 122  Q
    |||||||| |||||||||| | | || |||||| | |||||||| || || ||||||||||||||||| |||||||| ||  ||||||||||    
50390926 ttgatagcatttgatgtgccacagggtctctatgtagcttcagttattatcggattttgttttggtgctcaatggccgttactttttgccat 50391017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University