View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235Eco18 (Length: 196)
Name: NF0235Eco18
Description: NF0235-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0235Eco18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 1e-98; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 9 - 194
Target Start/End: Original strand, 50407788 - 50407973
Alignment:
Q |
9 |
tttatcctgtgtcggtcacttattgatagcctttgatgtgcaaaatggcctctattttgcttcagtaatcattggattttgttttggtgcacaatggcca |
108 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50407788 |
tttatcctgtgtcggtcacttattgatagcctttgatgtgcaaaatggcatctattttgcttcagtaatcattggattttgttttggtgcacaatggcca |
50407887 |
T |
 |
Q |
109 |
ttggtttttgccataatttcggagttgtttgggttgaaatattattcaactttgatgaactttggtggggtagctagtccaattgg |
194 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50407888 |
ttggtttttgccataatttcggagttgtttgggttgaaatattattcaactttgatgaactttggtggggtagctagtccaattgg |
50407973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 32 - 122
Target Start/End: Original strand, 50385782 - 50385872
Alignment:
Q |
32 |
tgatagcctttgatgtgcaaaatggcctctattttgcttcagtaatcattggattttgttttggtgcacaatggccattggtttttgccat |
122 |
Q |
|
|
||||||| |||||||||| | | || ||||| | |||||||| || |||||||||||||||||||| ||||||||||| |||||||||| |
|
|
T |
50385782 |
tgatagcatttgatgtgccagagggtctctacgtagcttcagtgattattggattttgttttggtgctcaatggccattactttttgccat |
50385872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 32 - 122
Target Start/End: Original strand, 50394201 - 50394291
Alignment:
Q |
32 |
tgatagcctttgatgtgcaaaatggcctctattttgcttcagtaatcattggattttgttttggtgcacaatggccattggtttttgccat |
122 |
Q |
|
|
||||||| |||||||||| | | || ||||| | |||||||| || |||||||||||||||||||| ||||||||||| |||||||||| |
|
|
T |
50394201 |
tgatagcatttgatgtgccagagggtctctacgtagcttcagtgattattggattttgttttggtgctcaatggccattactttttgccat |
50394291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 31 - 122
Target Start/End: Original strand, 50390926 - 50391017
Alignment:
Q |
31 |
ttgatagcctttgatgtgcaaaatggcctctattttgcttcagtaatcattggattttgttttggtgcacaatggccattggtttttgccat |
122 |
Q |
|
|
|||||||| |||||||||| | | || |||||| | |||||||| || || ||||||||||||||||| |||||||| || |||||||||| |
|
|
T |
50390926 |
ttgatagcatttgatgtgccacagggtctctatgtagcttcagttattatcggattttgttttggtgctcaatggccgttactttttgccat |
50391017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University