View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0235Eco26 (Length: 99)

Name: NF0235Eco26
Description: NF0235-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0235Eco26
NF0235Eco26
[»] chr3 (1 HSPs)
chr3 (8-95)||(36953872-36953959)


Alignment Details
Target: chr3 (Bit Score: 84; Significance: 2e-40; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 8 - 95
Target Start/End: Complemental strand, 36953959 - 36953872
Alignment:
Q  8 aagaataccttgacaagcagttttatttccagcattaatcactaaactatatttattaaaagaaactttaacataattgatatgaatt 95  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  36953959 aagaataccttgacaagcagttttatttccagcattaatcactaaactatctttattaaaagaaactttaacataattgatatgaatt 36953872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 7642 times since January 2019
Visitors: 9506