View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235Eco28 (Length: 158)
Name: NF0235Eco28
Description: NF0235-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235Eco28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 81; Significance: 2e-38; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 81; E-Value: 2e-38
Query Start/End: Original strand, 10 - 102
Target Start/End: Complemental strand, 30336686 - 30336594
Alignment:
| Q |
10 |
aatgttttaattcaaattaagtacacagtagatggataacaatttggtttatttagcaacaaatgaagatgaataagaattggagtgttgtta |
102 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
30336686 |
aatggtttaattcaaattaagtacacagtagatggataacaatttggtttatttagcaacaaatgaagatggataagaattggagtcttgtta |
30336594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1819 times since January 2019
Visitors: 2393