View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235Eco5 (Length: 132)
Name: NF0235Eco5
Description: NF0235-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235Eco5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 1e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 1e-45
Query Start/End: Original strand, 11 - 128
Target Start/End: Complemental strand, 28881967 - 28881850
Alignment:
| Q |
11 |
aatgccatggaaccagctaccaccaaacacaccaatggcaagcccagattctttgaccnnnnnnngtcaaaagccaatgtgacacccaaaaagagtacca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28881967 |
aatgccatggaaccagctaccaccaaacacaccaatggcaagcccaaattctttgacctttttttgtcaaaagccaatgtgacacccaaaaagagtacca |
28881868 |
T |
|
| Q |
111 |
aaaatgtgcaagagaatt |
128 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
28881867 |
aaaatgtgcaagagaatt |
28881850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 5e-17
Query Start/End: Original strand, 11 - 128
Target Start/End: Complemental strand, 28886972 - 28886855
Alignment:
| Q |
11 |
aatgccatggaaccagctaccaccaaacacaccaatggcaagcccagattctttgaccnnnnnnngtcaaaagccaatgtgacacccaaaaagagtacca |
110 |
Q |
| |
|
|||||||||| |||||||| |||||| || |||| || ||| |||| |||||||||| ||||||| | || |||||||||||||||||||||| |
|
|
| T |
28886972 |
aatgccatggcaccagctatcaccaagcataccattgtcaaccccaaattctttgacatctttttgtcaaaacctaacgtgacacccaaaaagagtacca |
28886873 |
T |
|
| Q |
111 |
aaaatgtgcaagagaatt |
128 |
Q |
| |
|
||||||| |||||||||| |
|
|
| T |
28886872 |
aaaatgtacaagagaatt |
28886855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 950 times since January 2019
Visitors: 2387