View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235Eco6 (Length: 326)
Name: NF0235Eco6
Description: NF0235-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235Eco6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 70; Significance: 2e-31; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 10 - 114
Target Start/End: Complemental strand, 374624 - 374520
Alignment:
| Q |
10 |
gggtttgaaattttttgagggggtaatgntattcattctattgggttttaatttttcatataaaaatttanacttgcttgnatgaaaacaaaaantattt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || |||| |||||||||||| || || |
|
|
| T |
374624 |
gggtttgaaattttttgagggggtaatgttattcattctattgggttttaatttttcatataaaaatttattttttcttggttgaaaacaaaaaataatt |
374525 |
T |
|
| Q |
110 |
ntttg |
114 |
Q |
| |
|
|||| |
|
|
| T |
374524 |
ttttg |
374520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1614 times since January 2019
Visitors: 2392