View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235_1D_high_16 (Length: 279)
Name: NF0235_1D_high_16
Description: NF0235_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235_1D_high_16 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 22 - 279
Target Start/End: Original strand, 42342254 - 42342511
Alignment:
| Q |
22 |
gataatccttgtaaagaaatgttgttgtagattcatatactttgttagtcttgatagattttaccttaatcaaatgatttagaaatgccttcagctgtgc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42342254 |
gataatccttgtaaagaaatgttgttgtagattcatatactttgttagtcttgatagattttaccttaatcaaatgatttagaaatgccttcagctgtgc |
42342353 |
T |
|
| Q |
122 |
cttttcctcgatctctcttttgtatcccgtaacattaagtgtgtgtccgtcctgatcaacatacatgaatttctaagtcaatcattgctctgattattgt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42342354 |
cttttcctcgatctctcttttgtatcccgtaatattaagtgtgtgtccgtcctgatcaacatacatgaatttctaagtcaatcattgctctgattattgt |
42342453 |
T |
|
| Q |
222 |
ctatgctttcaagatgacccaaaatgattgatagagcaactcttcttgaaaattttta |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42342454 |
ctatgctttcaagatgacccaaaatgattgatagagcaactcttcttgaaaaatttta |
42342511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2750 times since January 2019
Visitors: 2404