View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235_1D_high_21 (Length: 235)
Name: NF0235_1D_high_21
Description: NF0235_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235_1D_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 6 - 229
Target Start/End: Complemental strand, 54638649 - 54638426
Alignment:
| Q |
6 |
tttggtgtttccatctcctaggataacaactttatctcttggtggagctgaagctccatgctgtgacaaagagggtaggaagtaaccagcaaagtagtta |
105 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54638649 |
tttggggtttccatctcctaggataacaactttatctcttggtggagctgaagctccatgctgtgacaaagagggtaggaagtaaccagcaaagtagtta |
54638550 |
T |
 |
| Q |
106 |
cttgacacgtaagtgtatggaattccttctgcctcaatgctgcgccgaattctggctttaacggcgtatgcactctttgctggttcaactgcatgactcc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
54638549 |
cttgacacgtaagtgtatggaattccttctgactcaatgctgcgccgaattctggctttaacggcgtatgcactctttgctggttcaaccgcatgactcc |
54638450 |
T |
 |
| Q |
206 |
gatccacatcatttccgaattcag |
229 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
54638449 |
gatccacatcatttccgaattcag |
54638426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University