View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235_1D_high_4 (Length: 516)
Name: NF0235_1D_high_4
Description: NF0235_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0235_1D_high_4 |
 |  |
|
[»] chr6 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 434; Significance: 0; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 434; E-Value: 0
Query Start/End: Original strand, 55 - 516
Target Start/End: Original strand, 23332595 - 23333056
Alignment:
Q |
55 |
atatgtggacgaatgagcgatagaagcgcatgaccgatccaccctcacgttggacaatcattttcgacatgggaggaagaaatttgttaggatagttgat |
154 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23332595 |
atatatggacgaatgagcgatagaagcgcatgaccgatccaccctcacgtgggacaatcattttcgacatgggaggaagaaatttgttaggatagttgat |
23332694 |
T |
 |
Q |
155 |
ttcgactcctgatctctctgcgatagtcatatctagaagattcggctgtacataagtcagggtgacccacgcaccacgatctaccttatagaaacccttc |
254 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23332695 |
ttcgactcctgatctctctgcgatagtcatatctagaagattcggctgtacatacgtcagggtgacccacgcaccacgatctaccttatagaaacccttc |
23332794 |
T |
 |
Q |
255 |
agctcagcccaaccatcccgcagatagaccttgccatttttcacgtggaccttgacctcgaacatgtttctgtttggatcacgcaacatgacataatcat |
354 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23332795 |
agctcagcccaaccatcccgcagataaaccttgccatttttcacgtggaccttgaccttgaacatgtttctgtttggatcacgcaacatgacataatcat |
23332894 |
T |
 |
Q |
355 |
caacatgcacaccatattccttggcgaaacacgatggcaaccttgtcttcggctgaccaacacatcaaacacatgacacggttagttccaatcaacatac |
454 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23332895 |
caacatgcaaaccatattccttggcgaaacacgatggcaaccttgtcttcggctgaccaacacatcaaacacatgacacggttagttccaatcaacatac |
23332994 |
T |
 |
Q |
455 |
caaaacagtgcaatgcccactaatgaaccgactaactacatagcatgaatgataattgacag |
516 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23332995 |
caaaacagtgcaatgcccacaaatgaaccgactaactacatagcatgaatgataattgacag |
23333056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 282 - 376
Target Start/End: Complemental strand, 10955166 - 10955074
Alignment:
Q |
282 |
accttgccatttttcacgtggaccttgacctcgaacatgtttctgtttggatcacgcaacatgacataatcatcaacatgcacaccatattcctt |
376 |
Q |
|
|
|||||||| || ||| ||||||||| |||||||||||||| |||| |||||||||| |||||||| |||||||| |||| |||||||||||| |
|
|
T |
10955166 |
accttgcccttcttcttgtggaccttaacctcgaacatgttcttgttaggatcacgca--atgacatagtcatcaacgtgcaaaccatattcctt |
10955074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 18 - 60
Target Start/End: Original strand, 23322331 - 23322373
Alignment:
Q |
18 |
gacatcaccaaacacaatcgttgtaaaatccaaacgcatatgt |
60 |
Q |
|
|
||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
T |
23322331 |
gacatcaccaaacacaaacgttgtaaactccaaacgcatatgt |
23322373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 18 - 60
Target Start/End: Original strand, 23332498 - 23332540
Alignment:
Q |
18 |
gacatcaccaaacacaatcgttgtaaaatccaaacgcatatgt |
60 |
Q |
|
|
||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
T |
23332498 |
gacatcaccaaacacaaacgttgtaaactccaaacgcatatgt |
23332540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 282 - 349
Target Start/End: Original strand, 2027692 - 2027759
Alignment:
Q |
282 |
accttgccatttttcacgtggaccttgacctcgaacatgtttctgtttggatcacgcaacatgacata |
349 |
Q |
|
|
||||||||||||||| ||| || || ||||| |||||||| |||||||||||||||| |||||||| |
|
|
T |
2027692 |
accttgccatttttcttgtgaactttaacctcaaacatgttcttgtttggatcacgcaaaatgacata |
2027759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2149 times since January 2019
Visitors: 2399