View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235_1D_low_15 (Length: 334)
Name: NF0235_1D_low_15
Description: NF0235_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0235_1D_low_15 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 24 - 334
Target Start/End: Complemental strand, 10130538 - 10130233
Alignment:
Q |
24 |
tgtttcacccatcaagaaacggaggtaaaaacggtgatttaagaacaaaggagaatgaaacgatcgtgaagaaagcatgaggatggctgagattattgat |
123 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10130538 |
tgtttcacccatcaagaaacggaggtaaaaacggtgatttaagaacagaggagaatgaaacgatcgtgaagaaagcatgaggatggctgagattattgat |
10130439 |
T |
 |
Q |
124 |
tagtggtaactggtaactaacgagagagttaattactctaccttggttgaatgaaacgaggaagaaacaactttcgagattaggattaatgtgatgctac |
223 |
Q |
|
|
||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
10130438 |
tagtggtaatt-------aacgagagagttaattactctaccttggttgaatgaaacgaggaagaaacaattttcgagattaggattaatgtgatgctac |
10130346 |
T |
 |
Q |
224 |
cgggcaaatggactttttaaattgagtttaattgcatatgtg--aagtgattagtaacgtggcgcctacatggcatcagctgactgggcaaccacctcgc |
321 |
Q |
|
|
||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
T |
10130345 |
cggccaaatggactttttaaattgagtttaattgcatatgtgtcaagtgattagtaacgtggcgcctacatggcatcagctgactgggtaaccatctcgc |
10130246 |
T |
 |
Q |
322 |
tgactcaactttt |
334 |
Q |
|
|
|||||| ||||| |
|
|
T |
10130245 |
cgactcagctttt |
10130233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2511 times since January 2019
Visitors: 2401