View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235_1D_low_17 (Length: 326)
Name: NF0235_1D_low_17
Description: NF0235_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0235_1D_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 6 - 243
Target Start/End: Complemental strand, 3822472 - 3822236
Alignment:
Q |
6 |
ataattggtatcaaattgaaaagtggttgatttttcaatgaaccaatcgttttcaattataatcacttttataaactatagatagtcataatagaattca |
105 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
3822472 |
ataattggtatcaaattgaaaagtggttgatttttcaatgaaccaatcgttttcaattataatcacttttataa-ctatagatagtcataatagaattca |
3822374 |
T |
 |
Q |
106 |
tattggcaatatctttcgttcatgttactgttacactacgttgtttctccaagttgaatgattagtaggactttgagttgagtgaccttcacttttgtca |
205 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3822373 |
tattggcaatatctttcgttcatgttactgttacactacgttgtttctccaagttgaatgattagtaggactttgagttgagtgaccttcacttttgtca |
3822274 |
T |
 |
Q |
206 |
gcaatgaggtagtagctatagtacattttttgtttcat |
243 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
3822273 |
gcaatgaggtagtagctatagtacattttttgtttcat |
3822236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University