View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235_1D_low_23 (Length: 296)
Name: NF0235_1D_low_23
Description: NF0235_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235_1D_low_23 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 17 - 296
Target Start/End: Original strand, 779971 - 780262
Alignment:
| Q |
17 |
gacatcatagacgtcatctatcataagtgtatgtgctataaagctaatgacctagacaatccatcaacaaacagtgacgaagctggttggaaaccgttta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
779971 |
gacatcatagacgtcatctatcataagtgtatgtgctataaagctaatgacctagacaatccatcaacaaacagcgacgaagctggttggaaaccgttta |
780070 |
T |
 |
| Q |
117 |
-------ggaatcaatttgattgtgcgtgatggaatcaattttgtgttttatatcacttaactattcat----tactggaatagtaacaaataacactaa |
205 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
780071 |
aatactaggaatcaatttgattgtgcatgatggaatcaattttgtgttttatatcacttaactattcattagctactggaatagtaacaaataacactaa |
780170 |
T |
 |
| Q |
206 |
atggttatcaactttactattttaaggnnnnnnnacacctttgttctttataatggaca-ctccaaatcatggtaatggcatggatctggag |
296 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
780171 |
atggttatcaactttactattttaaggtttttttacacctttgttctttataatggacagctccaaatcaaggtaatggcatggatctggag |
780262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University