View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235_1D_low_25 (Length: 286)
Name: NF0235_1D_low_25
Description: NF0235_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235_1D_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 7 - 270
Target Start/End: Complemental strand, 3589868 - 3589611
Alignment:
| Q |
7 |
ataatcactattgaaaagaggtaaagttgtttgagtgtaattggccggtgaggaatttgaatcctctccgtttctatagagagagattcatctagagata |
106 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
3589868 |
ataatcactattgaagagaggtaaagttgtttgagtataattggccggtgaggaatttgaatcctctccgcttctatagagaga--ttcatctagagata |
3589771 |
T |
 |
| Q |
107 |
tcgatggaaaaataaaattatgaaaaattggtatattggatattcaataccccactttgtttatttgtatatttctctagtatggcaaaggatcccaact |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3589770 |
tcgatggaaaaataaaattatgaaaaattggtatattggatattcaatacaccactttgtttatttgtatatttctctagtatggcaaaggatcccaact |
3589671 |
T |
 |
| Q |
207 |
cagcaagtgagagtttcagtttggtccacatatgatatatatatgcatgtgaatcaaaagttcc |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3589670 |
cagcaagtgagagtttcagtttggtccacatatgat----atatgcatgtgaatcaaaagttcc |
3589611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University