View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235_1D_low_27 (Length: 277)
Name: NF0235_1D_low_27
Description: NF0235_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235_1D_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 24 - 192
Target Start/End: Complemental strand, 17000319 - 17000151
Alignment:
| Q |
24 |
tcacgaggttctcgtctatatacggttctgatagattcttctactaatctgagatttactaggtttgatttatgattctttgaaattttctatgatttca |
123 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17000319 |
tcacgaggttctcgtctatccacggttctgatagattcttctactaatctgagatttactagatttgatttatgattctttaaaattttctatgatttca |
17000220 |
T |
|
| Q |
124 |
attcaatttgttggtggttataaccagtttaattcaaaggagtctgcaaatgatataagcatatgcatg |
192 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
17000219 |
attcaatttgttggtggctataaccagtttaattcagaggagtctgcaaatgatataagcatatgcatg |
17000151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2708 times since January 2019
Visitors: 2402