View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235_1D_low_28 (Length: 273)
Name: NF0235_1D_low_28
Description: NF0235_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235_1D_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 40628868 - 40628614
Alignment:
| Q |
1 |
aatggagattttgataatatcagaactcatccctttctctattgcttatactgctgaattgtttcttctgagtcatattagtagtaaaagtgttggcttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40628868 |
aatggagattttgataatatcagaactcatccctttctctattgcttatactgctgaattgtttcttctgagtcatattagtagtaaaagtgttggcttg |
40628769 |
T |
|
| Q |
101 |
gcaggggtcatcttaattgtagtaatatctcaagctttcggaattgtttcaatacgaggaccagtaagagcacgtaaactgaatcnnnnnnnnggagcaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40628768 |
gcaggggtcatcttaattgtagtaatatctcaagctttcggaattgtttcaatacgaggaccagtaagagcacgtaaactgaatcaaaaaaaaggagcaa |
40628669 |
T |
|
| Q |
201 |
tattaaggctgctgacctcgagcttcttcacttacactttaattcttttagtgat |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40628668 |
tattaaggctgctgacctcgagcttcttcacttactctttaattcttttagtgat |
40628614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2619 times since January 2019
Visitors: 2402