View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235_1D_low_30 (Length: 254)
Name: NF0235_1D_low_30
Description: NF0235_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235_1D_low_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 23 - 243
Target Start/End: Complemental strand, 7184206 - 7183987
Alignment:
| Q |
23 |
tactcgtggtagatctggtgatatctccttggggttcagtcgaacctttcaccatctttcccaaacttcttatcgcggggattctagaatctgcttttcg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
7184206 |
tactcgtggtagatctggtgatatctccttggggttcagtcgaacctttcaccatctttcccaaacttcttatcgcggggattctaga-tcttcttttcg |
7184108 |
T |
|
| Q |
123 |
ctccgggatgtcattgctttgccgaccttttgcatctcttcgtactgtatgtacttctcagctttctccaatagattattgaaatcgtttagcttgtctt |
222 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7184107 |
ctccgggatgtcattgctttgtcgaccttttgcatctcttcgtactgtatgtacttctcagctttctccaatagattattgaaatcgtttagcttgtctt |
7184008 |
T |
|
| Q |
223 |
ttctgatgttatccacgaact |
243 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
7184007 |
ttctgatgttatccacgaact |
7183987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2747 times since January 2019
Visitors: 2404