View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235_1D_low_31 (Length: 246)
Name: NF0235_1D_low_31
Description: NF0235_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235_1D_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 4694350 - 4694433
Alignment:
| Q |
1 |
gttccctgctctgagttgggattattcttggttacatccctgaatatccaaatcatatctcaattggtatcatgttccgatcct |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4694350 |
gttccctgctctgagttgggattattcttggttacatccctgaatatccaaatcatatctcaattggtatcatgttccgatcct |
4694433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 39 - 111
Target Start/End: Original strand, 4686070 - 4686141
Alignment:
| Q |
39 |
cctgaatatccaaatcatatctcaattggtatcatgttccgatcctgagcgcattacaacataattgagattt |
111 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| || ||||||||| | || ||| | ||||||||||||| |
|
|
| T |
4686070 |
cctgaatatccaaatccaatctcaattggtatcacctt-cgatcctgatcacaatacgatataattgagattt |
4686141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University