View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235_1D_low_36 (Length: 229)
Name: NF0235_1D_low_36
Description: NF0235_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0235_1D_low_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 15 - 224
Target Start/End: Complemental strand, 15556673 - 15556464
Alignment:
Q |
15 |
attttcatcttcaaattcatcttccccttcatattcatatctgccaccaacatgttcttccaaattatgaacaatggtaacatcttcatccttttcattc |
114 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15556673 |
attttcatcttcaaattcatcttccccttcatattcatatctgccaccaacatgttcttccaaattatgaacaatggtaacatcttcatccttttcattc |
15556574 |
T |
 |
Q |
115 |
tgatcttcgttcactaaaacaaaatcttcatccaaattatccgtgctaccatcttctacattcatatctagtacccaatcatcgtcggaactaatgtcat |
214 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
15556573 |
tgatcttcgttcactaaaacaaaatcttcatccaaattatccgtgctaccatcttctacattcatatctagaacccaatcatcgtcggaactaatgtcat |
15556474 |
T |
 |
Q |
215 |
taaactccat |
224 |
Q |
|
|
||| ||||| |
|
|
T |
15556473 |
caaattccat |
15556464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University