View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235_1D_low_41 (Length: 209)
Name: NF0235_1D_low_41
Description: NF0235_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235_1D_low_41 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 63 - 193
Target Start/End: Original strand, 11681305 - 11681435
Alignment:
| Q |
63 |
agtcgtagctttgtgttttggttcagctgtctctgaagggtgcatggaccttttgctgagatgctgcggtttgtgctggttttgctggggttttcactgt |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| |||| ||||| |
|
|
| T |
11681305 |
agtcgtagctttgtgttttggttcagctgtctctgaagggtgcatggaccttttgctgtgatgctgcggtttgtgctagttttgctgggtttttgactgt |
11681404 |
T |
|
| Q |
163 |
ttgtctttgatgttttagcagtttaggcttg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
11681405 |
ttgtctttgatgttttagcagtttaggcttg |
11681435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 11681202 - 11681253
Alignment:
| Q |
1 |
ggaaatggagttgtctaggttgaagtcttctctatgtatgttctacgagatg |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11681202 |
ggaaatggagttgtctaggttgaagtcttctctatgtatgttctacgagatg |
11681253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2410 times since January 2019
Visitors: 2400