View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235_1D_low_43 (Length: 202)
Name: NF0235_1D_low_43
Description: NF0235_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0235_1D_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 8 - 196
Target Start/End: Complemental strand, 13797795 - 13797611
Alignment:
Q |
8 |
tgaacgtgaataccattaaaacaataatggaagcttgtaagaaggtggtcgtctatccctgcctcacatgtcccccatgccagacatgtctagctcatac |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| | ||||||||||||| ||| |
|
|
T |
13797795 |
tgaacgtgaataccattaaaacaataatggaagcttgtaagaagttggtcgtctatccctgcctcacatgtctcccatgcaaaacatgtctagctcgtac |
13797696 |
T |
 |
Q |
108 |
ctcatcgaaaggtgcaagtagctttaagttttaattttatataatatctaattaattaattaaataggctaagaaatgtgtcatattat |
196 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
13797695 |
ctcatcgaaaggtccaagtagctttaagttttaattttatataatatctaattaa----ttaaataggctaagaaatgtgtcatattat |
13797611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University