View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0235_2D_high_17 (Length: 258)

Name: NF0235_2D_high_17
Description: NF0235_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0235_2D_high_17
NF0235_2D_high_17
[»] chr3 (1 HSPs)
chr3 (23-247)||(7183983-7184206)


Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 23 - 247
Target Start/End: Complemental strand, 7184206 - 7183983
Alignment:
23 tactcgtggtagatctggtgatatctccttggggttcagtcgaacctttcaccatctttcccaaacttcttatcgcggggattctagaatctgcttttcg 122  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||    
7184206 tactcgtggtagatctggtgatatctccttggggttcagtcgaacctttcaccatctttcccaaacttcttatcgcggggattctaga-tcttcttttcg 7184108  T
123 ctccgggatgtcattgctttgccgaccttttgcatctcttcgtactgtatgtacttctcagctttctccaatagattattgaaatcgtttagcttgtctt 222  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7184107 ctccgggatgtcattgctttgtcgaccttttgcatctcttcgtactgtatgtacttctcagctttctccaatagattattgaaatcgtttagcttgtctt 7184008  T
223 ttctgatgttatccacgaacttcat 247  Q
    |||||||||||||||||||||||||    
7184007 ttctgatgttatccacgaacttcat 7183983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 189 times since January 2019
Visitors: 6633