View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235_2D_high_19 (Length: 250)
Name: NF0235_2D_high_19
Description: NF0235_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235_2D_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 17 - 230
Target Start/End: Complemental strand, 5460643 - 5460429
Alignment:
| Q |
17 |
tataaagtaaagacaggtaagtcgtgacaagaagattgaacaggtatcgattaggcctaaaggcatacagattatttactcaaggattatgaatatcttt |
116 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5460643 |
tataaagtaaagacaggtaagttgtgacaagaagattgaacaggtatcgattaggcctaaaggcatacagattatttactcaaggattatgaatatcttt |
5460544 |
T |
 |
| Q |
117 |
gagactataacctccgaattaagatgaaataaagttaccaaatctctattttgtcacttaacaaagcataataagagctatataaagccttct-ttttct |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5460543 |
gagactataacctccgaattaagatgaaataaagttaccaaatctctattttgtcacttaacagagcataataagagctatataaagccttcttttttct |
5460444 |
T |
 |
| Q |
216 |
tccttatgttcactc |
230 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
5460443 |
tccttatgttcactc |
5460429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University