View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235_2D_high_3 (Length: 602)
Name: NF0235_2D_high_3
Description: NF0235_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0235_2D_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 544; Significance: 0; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 544; E-Value: 0
Query Start/End: Original strand, 1 - 556
Target Start/End: Complemental strand, 48879886 - 48879331
Alignment:
Q |
1 |
aatgctgtctcaaattttgatttttgtcgatccagggtgtttttactggcatttgtggaacagaacttgatcacggtgttgcagtggttggatatggaac |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48879886 |
aatgctgtctcaaattttgatttttgtcgatccagggtgtttttactggcatttgtggaacagaacttgatcacggtgttgcagtggttggatatggaac |
48879787 |
T |
 |
Q |
101 |
agagaacgggatcgattactggttagtgaggaactcatggggttcatcatggggtgaaaatggctacattaagatggagagaaatttgttaacaaaagaa |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48879786 |
agagaacgggatcgattactggttagtgaggaactcatggggttcatcatggggtgaaaatggctacattaagatggagagaaatttgttaacaaaagaa |
48879687 |
T |
 |
Q |
201 |
actggcaagtgtggaattgcaatggaggcatcctatcctatcaagaagggtcagaacccaccaaatcctggtccttcacctccatcacctgttcagcctt |
300 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48879686 |
actggcaagtgtggaattgcaatggaggcatcatatcctatcaagaagggtcagaacccaccaaatcctggtccttcacctccatcacctgttcagcctt |
48879587 |
T |
 |
Q |
301 |
caactgtatgtgatgaatactactcttgctcagctggaaccacatgttgttgcctttttgagtatggaaacttctgctttgcttggggatgctgccctat |
400 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48879586 |
caactgtatgtgatgaatactactcttgctcagctggaaccacatgttgttgcctttttgagtatggaaacttctgctttgcttggggatgctgccctat |
48879487 |
T |
 |
Q |
401 |
tgagtctgcaacttgctgcgacgacggttccagctgttgccctcatgactacccggtctgcgatgttgaagctggaacttgccgattggtaattatctta |
500 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48879486 |
tgagtctgcaacttgctgcgatgacggttccagctgttgccctcatgactacccggtctgcgatgttgaagctggaacttgccgattggtaattatctta |
48879387 |
T |
 |
Q |
501 |
tttcttccttaagtctatttctattacaaataagaaccatcaaacatgtgttgcaa |
556 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
48879386 |
tttcttccttaagtctatttctattacagataagaaccatcaaacatgtgttgcaa |
48879331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 216 - 256
Target Start/End: Original strand, 24743655 - 24743695
Alignment:
Q |
216 |
attgcaatggaggcatcctatcctatcaagaagggtcagaa |
256 |
Q |
|
|
|||||||||||| |||| |||||||||||||| |||||||| |
|
|
T |
24743655 |
attgcaatggagccatcatatcctatcaagaatggtcagaa |
24743695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University