View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235_2D_high_30 (Length: 203)
Name: NF0235_2D_high_30
Description: NF0235_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235_2D_high_30 |
 | |
|
| [»] scaffold0011 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0011 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 32 - 198
Target Start/End: Complemental strand, 17437 - 17271
Alignment:
| Q |
32 |
taggctgttgcaaattgggttgtgcttaccaagtaacaaaaagttaaacaatgaatagtaggcaatcttgaaaggccataagtgaatggactatatttag |
131 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17437 |
taggctgttgcaaattgggttgtgcttactaagtaacaaaaagttaaacaatgaatagtaggcaatcttgaaaggccataagtgaatggactatatttag |
17338 |
T |
|
| Q |
132 |
agattgcaagcaacaaaagttcagatgaccattttatgggttgaattaatccctctttcatatcagt |
198 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17337 |
agattgcaagtaacaaaagttcagatgaccattttatgggttgaattaatccctctttcatatcagt |
17271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 65; Significance: 9e-29; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 61 - 157
Target Start/End: Original strand, 16381881 - 16381977
Alignment:
| Q |
61 |
caagtaacaaaaagttaaacaatgaatagtaggcaatcttgaaaggccataagtgaatggactatatttagagattgcaagcaacaaaagttcagat |
157 |
Q |
| |
|
||||| |||||| ||||||||||||| | ||||||||||||||| |||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
16381881 |
caagtgacaaaaggttaaacaatgaacaataggcaatcttgaaatcccataagtgaatggactatatttagatattgcaaacaacaaaagttcagat |
16381977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 62 - 167
Target Start/End: Original strand, 17579442 - 17579547
Alignment:
| Q |
62 |
aagtaacaaaaagttaaacaatgaatagtaggcaatcttgaaaggccataagtgaatggactatatttagagattgcaagcaacaaaagttcagatgacc |
161 |
Q |
| |
|
||||| ||||| |||| |||||||||| | ||||||||||||| |||||||||||||| ||||| ||||||||| ||||||| |||||||||||| || |
|
|
| T |
17579442 |
aagtagcaaaaggttagacaatgaataatgggcaatcttgaaatcccataagtgaatgggctatacttagagattccaagcaagcaaagttcagatgtcc |
17579541 |
T |
|
| Q |
162 |
atttta |
167 |
Q |
| |
|
| |||| |
|
|
| T |
17579542 |
acttta |
17579547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 146 times since January 2019
Visitors: 2407