View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235_2D_low_12 (Length: 473)
Name: NF0235_2D_low_12
Description: NF0235_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235_2D_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 116 - 470
Target Start/End: Complemental strand, 25595216 - 25594862
Alignment:
| Q |
116 |
cctttccgctattttaacctcaaattataaaacccaataaaagtttcacaaattaaaaaagaaagtaaccttgtacgggtcgattgttttggcttcggat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25595216 |
cctttccgctattttaacctcaaattataaaacccaataaaagtttcacaaattaaaaaagaaagtaaccttgtacgggtcgattgttttggcttcggat |
25595117 |
T |
 |
| Q |
216 |
tgtaaaaggaaacacaaggcggcgacggtgacgatcaatgtggtggctgaacgggtcatcgtgacggtgacggaatcaaaactgagaacggtgttttaac |
315 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25595116 |
tgtaaaaggaaacacaaggcggcgaaggtgacgatcaatgtggtggctgaaagggtcatcgtgacggtgacggaatcgaaactgagaacggtgttttaac |
25595017 |
T |
 |
| Q |
316 |
gtaacggtgacggaattgatcggagtgttcgtgtaaataagttcgcgggaagaatgtctagatgcttcgaggctttatatgctgtcgttgtatgacgtgg |
415 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25595016 |
gtaacggtgacggaattgatcggagtgttcgtgtaaataagttcgcgggaagaatgtctagatgcttcgaggctttatatgctgtcgttgtatgacgtgg |
25594917 |
T |
 |
| Q |
416 |
cactttgatgtgtcaccacgcatactgaccaatcatatttcagagtttcttttct |
470 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25594916 |
cactttgatgtgtcaccacgcatactgaccaatcatatttcagagtttcttttct |
25594862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University