View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235_2D_low_32 (Length: 275)
Name: NF0235_2D_low_32
Description: NF0235_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235_2D_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 15 - 252
Target Start/End: Original strand, 3822236 - 3822472
Alignment:
| Q |
15 |
atgaaacaaaaaatgtactatagctactacctcattgctgacaaaagtgaaggtcactcaactcaaagtcctactaatcattcaacttggagaaacaacg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3822236 |
atgaaacaaaaaatgtactatagctactacctcattgctgacaaaagtgaaggtcactcaactcaaagtcctactaatcattcaacttggagaaacaacg |
3822335 |
T |
 |
| Q |
115 |
tagtgtaacagtaacatgaacgaaagatattgccaatatgaattctattatgactatctatagtttataaaagtgattataattgaaaacgattggttca |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3822336 |
tagtgtaacagtaacatgaacgaaagatattgccaatatgaattctattatgactatctatag-ttataaaagtgattataattgaaaacgattggttca |
3822434 |
T |
 |
| Q |
215 |
ttgaaaaatcaaccacttttcaatttgataccaattat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3822435 |
ttgaaaaatcaaccacttttcaatttgataccaattat |
3822472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University