View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235_2D_low_42 (Length: 249)
Name: NF0235_2D_low_42
Description: NF0235_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0235_2D_low_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 5460903 - 5461119
Alignment:
Q |
1 |
ttaaagcttatgctcaataattgtttatgaagatttagtccaaataagtaacagctaaataatgttcacccaaacccttctgcttgcttccaaaactcac |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
5460903 |
ttaaagcttatgctcaataattgtttatgaagatttagtccaaataagtaacagctaaataatgttcacccaaacccttctgtt---------------- |
5460986 |
T |
 |
Q |
101 |
cttgtgaacttccttatacttttcttgatcgaccaacttgacacaactaatcattattctaatcattgatattaatttcttctctcttttatatttttca |
200 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5460987 |
-----gaacttccttatacttttcttgattgaccaacttgacacaactaatcattattctaatcattgatattaatttcttctctcttttatatttttca |
5461081 |
T |
 |
Q |
201 |
aactgtccatttcaaacataacctgtaatcactgatgt |
238 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
5461082 |
aactgtccatttcaaacataacctgtaatcactgatgt |
5461119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University