View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235_2D_low_53 (Length: 220)
Name: NF0235_2D_low_53
Description: NF0235_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0235_2D_low_53 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 82 - 220
Target Start/End: Complemental strand, 52710847 - 52710709
Alignment:
Q |
82 |
aagaaaattgctttaataggtttttaaggaataaaccccatcattttaaagacaactgctataaaccaatcgtttaagaaattataatatgaatgtatca |
181 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52710847 |
aagaaaattgctttaataggtttttaaggaataaaccccatcattttaaagacaactgctataaaccaatcgtttaagaaattataatatgaatgtatca |
52710748 |
T |
 |
Q |
182 |
atatcactatggctgagttcagacttcagagtacaatga |
220 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52710747 |
atatcactatggctgagttcagacttcagagtacaatga |
52710709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2430 times since January 2019
Visitors: 2401