View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0235_2D_low_54 (Length: 220)

Name: NF0235_2D_low_54
Description: NF0235_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0235_2D_low_54
NF0235_2D_low_54
[»] chr3 (1 HSPs)
chr3 (82-220)||(52710709-52710847)


Alignment Details
Target: chr3 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 82 - 220
Target Start/End: Complemental strand, 52710847 - 52710709
Alignment:
82 aagaaaattgctttaataggtttttaaggaataaaccccatcattttaaagacaactgctataaaccaatcgtttaagaaattataatatgaatgtatca 181  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52710847 aagaaaattgctttaataggtttttaaggaataaaccccatcattttaaagacaactgctataaaccaatcgtttaagaaattataatatgaatgtatca 52710748  T
182 atatcactatggctgagttcagacttcagagtacaatga 220  Q
    |||||||||||||||||||||||||||||||||||||||    
52710747 atatcactatggctgagttcagacttcagagtacaatga 52710709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2558 times since January 2019
Visitors: 2401