View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235_high_13 (Length: 359)
Name: NF0235_high_13
Description: NF0235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0235_high_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 1 - 354
Target Start/End: Complemental strand, 29007342 - 29006989
Alignment:
| Q |
1 |
gtgcagatgagggtcgtttgggtgttccattgattacactcgtaatcatccgagctttcgcttggtcttannnnnnngttcacctttcagctatcaacta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29007342 |
gtgcagatgagggtcgtttgggtgttccattgattacactcgtaatcatcttagctttcgcttggtcttctttttttgttcacctttcagctatcaacta |
29007243 |
T |
|
| Q |
101 |
gctagctcacactagacagtttatttcactgatgtgggtgtttggtcatttataatgacatattgtttagtacatatagattgtgatttggtttagtgac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29007242 |
gctagctcacactagacagtttatttcactgatgtgggtgtttggtcattcataatgacatattgtttagtacatatagattgtgatttggtttagtgac |
29007143 |
T |
|
| Q |
201 |
tttagtcaattgttccaaagtgagtgatgttcttgtgttgctaatgtgagaatctttgctactgtgaatttgtttgttagcaaatgaacttgtttagttc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29007142 |
tttagtcaattgttccaaagtgagtgatgatcttgtgttgctaatgtgagaatctttgctactgtgaatttgtttgttagcaaatgaacttgtttagttc |
29007043 |
T |
|
| Q |
301 |
aaagtaaactctgtatactcaatttgagaatttgattgtagactctctgctcct |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29007042 |
aaagtaaactctgtatactcaatttgagaatttgattgtagactctttgctcct |
29006989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2616 times since January 2019
Visitors: 2402