View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0235_low_24 (Length: 330)
Name: NF0235_low_24
Description: NF0235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0235_low_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 104; Significance: 8e-52; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 111 - 240
Target Start/End: Original strand, 32992665 - 32992791
Alignment:
Q |
111 |
tgttttgggtctaaaattgtacatttgtgtagtggggaccactcatcaatgaagcaaggtcactattgggggcattggcatataataaaactaattaatc |
210 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
32992665 |
tgttttgggtctaaaattgtacatttgtgtagtggggaccactcaccaatgaagccaggtcactattgggggcattggcat---ataaaactaattaatc |
32992761 |
T |
 |
Q |
211 |
taaatcaacttgagttggatattcttcgac |
240 |
Q |
|
|
|||||||||||||||||||| ||||||||| |
|
|
T |
32992762 |
taaatcaacttgagttggattttcttcgac |
32992791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1665 times since January 2019
Visitors: 2392