View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0235_low_24 (Length: 330)

Name: NF0235_low_24
Description: NF0235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0235_low_24
NF0235_low_24
[»] chr6 (1 HSPs)
chr6 (111-240)||(32992665-32992791)


Alignment Details
Target: chr6 (Bit Score: 104; Significance: 8e-52; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 111 - 240
Target Start/End: Original strand, 32992665 - 32992791
Alignment:
111 tgttttgggtctaaaattgtacatttgtgtagtggggaccactcatcaatgaagcaaggtcactattgggggcattggcatataataaaactaattaatc 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||   ||||||||||||||||    
32992665 tgttttgggtctaaaattgtacatttgtgtagtggggaccactcaccaatgaagccaggtcactattgggggcattggcat---ataaaactaattaatc 32992761  T
211 taaatcaacttgagttggatattcttcgac 240  Q
    |||||||||||||||||||| |||||||||    
32992762 taaatcaacttgagttggattttcttcgac 32992791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University